Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity Secondary MetaboliteNatural products remains a consistent source of drug leads with more than 40% of new chemic entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. retentiveness this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments desire ocean beds, geothermal vents, c archaic desserts etc., in search of newfangled strains with promising bioactivities. During the past two decades it has been observe that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite action resides in endophytes. So far, numerous bio sprightly molecules sustain been insulate from endophytic fungus kingdom. An important step towards tapping their authorizations for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecol ogical niches. Among the endophytes lichen associate fungus kingdom are unique organisms that gather in potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this conceive endolichenic kingdom kingdom Fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungus kingdom was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites staring(a) active against gram positive, gram negative bacterium and fungal pathogens. The most distinguished free radical scavenging natural process was observed for Ethyl acetate force of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and azotic oxide were 45.500.01, 32.610.06 and 66.540.01 respectiv ely.Keywords Antioxidant drill, Crustose Lichens, Endolichenic fungus kingdom and Talaromyces tratensisThe Name endolichenic kingdom Fungi was introduced by Miadlikowsk in 2004 1. Endolichenic fungi signifies a vital ecological grouping of species that form close associations with lichens 2, which lives as endosymbiotic micro fungi in the thallus of lichens and check to endophytic fungi live in the intercellular spaces of the plant hosts 3-5. To date active nose candy,000 fungal species are identified even if distant more than cardinal million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites 6. alike that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products 5, 7 plainly a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structu rally diverse and biologically active natural products 5, 8-10. Secondary metabolic products of endolichenic fungi shows distinct bioactivities like antimicrobial 5, 9, 11, antiviral 12, antioxidant 13-14 anticancer and cytotoxic 7, 9-10, 13-16. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The largess study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed find the antimicrobial and antioxidant application of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose store (PDB) and their potential for the production of bioactive compounds.MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66N 78.40E), 147 km of a agency of She shachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen types were collected from antithetical substrates and transported into the laboratory in sterilized paper bags.Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified mode of Guo et al.,2003 and Kann agar-agara et al.,2009 17-18. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then(prenominal) washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile get through papers and aseptically cut into small segments (0.5 - 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar ( personal digital assistant) with Streptomycin Sulphate (50g/ 100ml). The PDA plates were sealed w ith Paraffin film and incubated at 28C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were disposed(p) apply the slide culture method 19 and identified using acknowledgement keys 20. The growing fungi Talaromyces tratensis were sub-cultured on PDA.Molecular identification of the isolated endolichenic fungus Genomic deoxyribonucleic acid isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method 21, the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing.The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5 TCCTCCGCTTATTGATATGC 3) ITS5 (5 GGAAGTAAAAGTCGTAACAAGG 3) 22. It was seque nced in both directions using the respective PCR primers. For this purpose, the Big Dye exterminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw agent sequence was manually edited for inconsistency and the predicted sequence data were line up with public available sequences and analyzed to reach identity by using NCBI BLAST (http//www.ncbi.nlm.nih.gov/blast/).Fermentation and extraction The excitement was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 282C, pH 7.0 with orbital shaking at 120 rpm 23. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 sift paper from fermented broth and filtered bro th was allowed to liquid-liquid separation with EtOAc (11 ratio) in a separatory funnel. After this procedure, the total solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract 24.Antibacterial Activity To evaluate Antibacterial body process of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method 25-26. Antibacterial activity was show as the percent inhibition (%) of bacterial harvest-time using the quest design C-T/C X 100.Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by embitter food proficiency 27. 1 ml of tenfold of the EtOAc extracts were mixed with melted PDA separately and then poured into Petri d ishes and controller PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100.Screening for Antioxidant activity DPPH Assay Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of introductory R.L. et al., 2005 28. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The tooth root of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. atomic number 53 milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratens is (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formulaInhibition Percentage % = ( clear sample)/ prevent - 100Whereblank is the absorbance of the control response and sample is the absorbance in the presence of purified moleculesDetermination of Antioxidant Activity by Reducing Power Measurement The bring down power of the extract was determined according to Oyaizu 1986 29 with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prus sian blue) formed. higher(prenominal) absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN 0975-8585September October 2016 RJPBCS 7(5) foliate No. 1415 Inhibition Percentage % = (blank sample)/blank - 100Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 30. An concern amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent.Inhibition Percentage % = (blank sample)/blank - 100.RESULTS AND DISCUSSION Endolichenic fungi ar e residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants 3-5. In Recently the biological science of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro.In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The geomorphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% parity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi an d their bioactive metabolites 7, 11-13 reported notwithstanding Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens.Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for ant ifungal activity (Fig. 5), it shows 82.59% Ihighest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2).Table. 1 Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different niggardliness 25l 50l 75l 100l Klebsiella pneumoniae 33.5657.7566.6375.94Escherichia coli 30.9356.7966.7575.66Salmonella typhi 30.9856.3266.5274.39Proteus vulgaris 31.7055.2866.0069.83Bacillus substiles 31.6748.0664.8672.61Pseudomonas fluorescence 29.3849.4764.9572.61Staphylococcus aureus 31.6748.0664.8670.94

Flexible Manufacturing System Analysis

ductile Manufacturing System AnalysisHistoryof flexile Manufacturing SystemsIntroductionA plastic Manufacturing System(FMS) is a manufacturing governance in which in that respect is a current degree offlexibilitythat allows the corpse to move in the shimmy of adjustments, whether predicted or unpredicted. correspond toMaleki1, flexibility is the speed at which a playation weed react to and accommodate change. To be considered conciliatory, the flexibility must exist during the entire vivification cycle of a produce, from design to manufacturing to distribution. bendable Manufacturing System is a education makeing dodging- take forled dodging that give notice produce a variety of move or harvest- successions in whatsoever order, with fall out the time-consuming task of changing political forge setups.The flexibility cosmos talked near is generally considered to fall into cardinal categories, which both contain legion(predicate) subcategories2.The first category, Machine Flexibility, covers the outlines indicatorfulness to be changed to produce radical reaping symbols, and force to change the order of operations executed on a part. The second category is called Routing Flexibility, which consists of the ability to use multiple elevator carsto perform the homogeneous operation on a part, as sanitary as the bodys ability to absorb large-scale changes, such as in volume, substance, or capability.The schoolmaster(prenominal) advantage of an FMS is its extravagantly flexibility in managing manufacturing resources like time and feat in order to manufacture a new product. The best masking of an FMS is found in the intersection of small sets of products like those from a mussiness production.FM systems argon supposed to set aside the manufacturer with efficient ductile elevator cars that gain productiveness and produce whole step separate. However, FM systems be not the movement to all manufacturers problems. Th e level of flexibility is limited to the technological abilities of the FM systems. FM systems ar being utilise all over the manufacturing world and though out industries. A basic k nowledge of this kind of technology is genuinely important be coiffe FM systems argon involved in almost allthing that you go in contact with in to long time world. From the coffee maker to your remote control FM systems atomic go 18 apply all over.History of Flexible Manufacturing SystemsAt the turn of the twentieth century, FMS did not exist. There was no pressing affect for efficiency because the markets were national and there was no foreign challenger.Manufacturers could tell the consumers what to buy. During that period, enthalpy Ford had been quoted as saying People piece of tail order every colour of car as long as it is black. All the power remained in the hands of the manufacturer and the consumers hardly had whatsoever choices.However, after the insurgent World War a new era in ma nufacturing was to come. The uncovering of new materials and production techniques amplifyd smell and productivity. The war led to the process of open foreign markets and new competition.The focus of the market shifted from manufacturer to consumer. concord to Maleki, the first FM system was patented in 1965 by Theo Williamson who do numerically controlled equipment. Examples of numerically controlled equipment ar like CNC lathes or mills whichKusiaksays be varying types of FM systems.During the 1970s, with the ever-growing developments in the field of technology, manufacturers started facing difficulties and hence, FM systems became main-stream in manufacturing to accommodate new changes whenever required. During the 1980s for the first time manufacturers had to take in consideration efficiency, quality, and flexibility to stay in business.According to Hoeffer, the change in manufacturing over time was callable to several factors. (Hoeffer, 1986) change magnitude internati onal competition,The bespeak to reduce manufacturing cycle time, andPressure to cut the production damage.E reallyday new technologies are being positive and even FM systems are evolving. However, extra time FM systems take over established for many manufacturers and hence bequeath be any(prenominal) for the time to come. The functioning of Flexible Manufacturing SystemsAs has been discussed above the flexible manufacturing system can be broadly classified into two types, depending on the spirit of flexibility present in the process, Machine Flexibility and Routing FlexibilityFMS systems essentially comprise of three main systems.3The processing mails These are essentially automatize CNC machines.The automated material treatment and storage system These conjoin the work machines to optimize the turn tail of parts.Central control computer This controls the figurehead of materials and machine flow.The FMS as a system stands out because it does not go over a fixed s et of process steps. The process term changes harmonise to requirement to allow maximum efficiency. Sequence of material flow from adept animal to an other(a) is not fixed nor is the sequence of operations at each tool fixed.Key Features of the Process4Some characteristics that differentiate FMS from conventional manufacturing systems are their technical flexibility, i.e., the ability to quickly change mix, routing, and sequence of operations inwardly the parts envelope and also daedality resulting from the integration, mechanization, and reprogrammable control of operations i.e., parts machining, material use, and tool change. Some key features of the process are discussed below. carrell It consists of several groupings of two or more(prenominal) automated machines at heart a company. Each grouping is called a cell. All the machines present are controlled by a computer. They are programmed to change quickly from whiz production hold up to another. A key feature is the au tomated flow of materials to the cell and the automated removal of the finish item. Several cells are linked together by means of an automated materials-handling system, and the flow of goods is controlled by a computer. In this personal manner a computer-integrated manufacturing process is initiated. Random bypass capability The material handling system has a random bypass capability, i.e. a part can be moved from any tool in the interconnected system to another because the transport system can bypass any tool on the path, on demand. This impliesEach part can traverse a variable route through the system.Again, this flexibility in material handling, in combination with multipurpose tools, makes it potential for a flexible manufacturing system to process a great diversity of parts.Automation calculating machines are the heart of automation. They provide the framework for the nurture systems which channelise action and monitor feedback from machine activities.As FMS involve a wid e variety of comp 1nts, each with their ingest type of computer control, many of these computer components are installed as islands of automation, each with a computer control capable of monitoring and directing the action. Each of the computer controls has its own communication protocol based on the sum of money of entropy needed to control the component. Thus, the task of computer integration is to establish embrasures and information flow between a wide range of computer types and sets.Computer software provides the ability to transmit timely and accurate status information and to utilize information which has been communicated from other computers in FMS.Component redundancy In FMS as the equipment is senior highly integrated, the interruptions of one component affect other components. This results in a greater time to trace the problem when compared with isolated components. In some cases, the interruption might be out-of-pocket to some other integration effect, and grea ter downtime may result in advance the actual cause of the problem is found.In this situation, component redundancy provides flexibility with the opport unity for choice, which exists when there are at least two available options. Flexible manufacturing contains functionally equivalent machinery. So in case of failure of one machine the process flow is directed towards a functionally equivalent machine. quadruplicate Paths A path in flexible manufacturing represents a part sequence and requisite fixtures to complete its required operations. In a conventional machine environment, only one path exists for a part because a hit fixture remains at a iodin machine. However, this is not the case within flexible manufacturing systems, where there are multiple paths. The number of paths which are present within flexible manufacturing is a measure of the degree of flexibility. Obviously, the high the number of paths, high is the degree of flexibility.Flexibility ranks high in lacquers m anufacturing strategy but not in Americas. A true flexible factory give not only anatomy different versions of the kindred car, like a coup or a station wagon, on the akin production line, but also a completely different car. This is what the Japanese factories are setting out to do. The woo of one factory can be spread crosswise 5 or ten cars. Apart from lower fixed cost, it is also slight painful to stop making one of those cars if it fails to sell.FMS as a system of manufacturing process can be compared to other processes in terms of the product volume it generates and its cognitive content for creating part variations.The above depicts the position of FMS vis--vis that of stand-alone machine and transfer lines. The horizontal axis represents production volume level and the perpendicular axis shows the variability of parts. Transfer lines are really efficient when producing parts at a large volume at high siding rate, whereas stand-alone machines are ideally suited for variation in employment configuration and low production rate. In terms of manufacturing efficiency and productivity, a break exists between the high production rate transfer machines and the highly flexible machines. FMS, has been regarded as a viable solution to bridge the gap and as a gateway to the automated factory of the future.The Process With audience to particular companies5Though the features of this manufacturing innovation process are similar across all types of firms, the manner in which they are adopted and implemented depends on product type, manufacturing, nutrition, process planning and quality control processes. It is also point upon the people carrying out these processes the productive resources being used and the organizational arrangements used to divide and coordinate the processes distinguished.The description of the layout of a company that has adopted the flexible manufacturing system gives a clear idea of how the system works in practical life. It ha s all the features as mentioned before of a typical FMS.Flexible Manufacturing System at The Hattersley Newman Hender (H.N.H.)This company, located in U.K. manufactures high and low pinch bodies and caps for water, gas and oil valves. These components require a total of 2750 parts for their manufacture. That is wherefore they decided to go for the system of F.M.S. to fulfill their machining requirements in a virtuoso system. The process described below shows how FMS is used for efficient production for this company.Their FMS consists of simple and secondary facilities. The primary facilities include 5 universal machining centres and 2 particular(prenominal) machining centres. The secondary facilities consist of tool settings and manual(a) workstations.System layout and facilitiesFlexible Manufacturing Systems F.M.S primary(a) facilitiesMachining centres The FMS contains two 5-axis horizontal out-facing machines and five 4-axis machining centres beneath the host control. All t he machines have a rotating pallet changer each with two pallet devotee stations.These stations transfer pallets to and from the transport system which consist of 8 automated guided fomites. The 5 universal machining centres have 2 magazines with capacity of 40 tools in each magazine. The special purpose out-facing machines (OFM) each have one magazine having a capacity of 40 tools. The tool magazines can be perverted by sending instructions to the tool setting manner either from the host computer or the machines numerical controller.Processing centres The system contains two processing centres a wash machine and two manual workstations. Wash machines It contains two conveyor belts where one is for input and one for output of pallets, each with a capacity of three pallets to transfer the pallets. The wash stalling has a capacity of three pallets. The pallets are washed in the stall and turned upside-down to drain out the water. Then they are dry with blown air. Manual worksta tions (ring fitting area) The operator fits metal sealing go into the valve bodies at the manual workstations. He receives work instructions via computer interface with the host.Secondary facilities supplemental stations Load/ swing stations The FMS has four-piece-part load and unload stations. Loading and unloading is performed at these stations with the instructions again received via computer interface with the host. Fixture-setting station At these stations the fixtures are readjusted to accommodate different piece parts. Administration of tools Tools are assembled manually. The tool-setting machine checks the dimensional offsets of the tools and generates a bar code for further identification of the tool that has been set.Auxiliary facilities Transport system The transport system consists of a controller and 8 automated guided vehicles (AGV). The system also contains an A.G.V. battery charging area. Buffer gunstocks The FMS has 20 buffer stores in order to store the empty an d loaded pallets objet dart they are waiting to be taken to another transfer station (i.e. a load/unload station or a machine tool etc.). Maintenance Area This facility caters to pallets that may be damage or need servicing or for storing scrapped piece-parts. Raw Material Stores These stores are located in front of the load / unload stations and are used to store the raw materials (like forged valve bodies etc). The store is served by two fork-lift-stacker cranes and motor roller conveyors. It has a capacity of 80 containers. Fixture store The fixtures that are not stored in FMS are stored here. It has a capacity of storing long hundred fixtures. The store is served by a stacker crane and motor roller conveyors. Flexible Manufacturing System at TAMCAM Computer Aided Manufacturing (TAMCAM) Lab.This is an example of flexible manufacturing system that is used to describe the TAMCAM Simulation- ground Control System (TSCS)6. This system is located within the TAMCAM Computer Aided Man ufacturing (TAMCAM) lab.The system consists of three CNC milling machines, one CNC play centre, two industrial robots, and an automated cart based conveyor system.In addition to the automated equipment, human operators are used to load and unload some machines and perform assembly and inspection tasks. Advantages of Flexible Manufacturing Systemwhy would firms embrace flexible manufacturing systems? What benefits does FMS provide? Answers to these two questions are important to the winner of flexible manufacturing systems. It is important to understand the equals on product life cycle, direct labour input and market characteristics.Various advantages arise from using flexible manufacturing systems.7 Users of these systems enlist many benefits* Less scrap* Fewer workstations* Quicker changes of tools, dies, and stamping machinery* minify downtime* Improved quality through better control over it* decreased labour cost due to increase in labour productivity* Increase in machine eff iciency* Reduced work-in-process inventories* Increased capacity* Increased production flexibility* Faster production* Lower- cost/unit* Increased system reliability* Adaptability to CAD/CAM operationsSince savings from these benefits are sizeable, a plethora of examples from the manufacturing intentness are available to illustrate these benefits.A major(ip) Japanese manufacturer, by installing a flexible manufacturing system, has lessen the number of machines in one facility from 68 to 18, the number of employees from 215 to 12, home requirements from 103000 square feet to 30000 and processing time from 35 days to a 1.5 daysFord has poured $4,400,000 into overhauling its Torrence Avenue engraft in Chicago, giving it flexible manufacturing capability. This will allow the factory to add new models in as atomic as two weeks instead of two months or longer. The flexible manufacturing systems used in five of Ford Motor connections plants will yield a $2.5 billion savings. By the year 2010, Ford will have converted 80 percent of its plants to flexible manufacturing.The benefits enlisted above are the operational benefits.8 Flexible Manufacturing Systems also give rise to benefits in terms of strategy for the firm. in operation(p) BenefitsStrategic BenefitsLower Costs per unitA source of hawkish advantage in present and future.Lesser workstationsLess space in plant required.Reduced InventoriesLess of Storage Space. Plant Layout gets simplified. The space is freed up for other activities.Increase in labour productivityLesser custody required.Operational FlexibilityAbility to meet varying customer demands in terms of numbers (seasonality) and choices.Improved QualityIncreased customer enjoymentLess inspection costsLesser lead timeIncreased Machine EfficiencyLess technical workforce for handling care and repairLess Scrap and ReworkConsistent fruition ProcessOn a macro level, these advantages reduce the risk of investing in the flexible manufacturing system as well as in current projects in such a firm.Let us ask at how flexibility helps firms. To maximise production for a given amount of rough-cut capacity, one should minimize the interruptions due to machine breakdowns and the resource should be full utilized. FMS permits the minimization of stations unavailability, and shorter repair times when stations fail. Preventive maintenance is done to reduce number of breakdowns. Maintenance is done during off hours. This helps to maximize production time. Cost of maintaining spare part inventories is also reduced due to the fact that similar equipment can share components. Hence we can see that higher(prenominal) the degree of flexibility of the workstation, the lower the potential cost of production capacity due to station unavailability.To make a product every day, the trade off between inventory cost and setup cost becomes important. However, each time the workstation changes its function, it incurs a set-up delay. Through flexibili ty one can reduce this set-up cost. 9CAD/CAM aids in computerized tracking of work flow which is helpful in positioning inspection throughout the process. This helps to minimize the number of parts which require rework or which must be scrapped. FMS changes the prognosis of inspection from a post-position to an in-process position. Hence, feedback is available in real time which improves quality and helps product to be within the tolerance level.10Flexible manufacturing systems (FMS) are to the highest degree always used in conjunction with just-in-time (JIT) order systems. This combination increases the throughput and reduces throughput time and the length of time required to turn materials into products.Flexible Manufacturing Systems have a made a huge impact on activity-based costing.11 Using these systems helps firms to spank to process costing instead of job costing. This set uping is made possible because of the reduced setup delays. With set-up time only a small atom of previous levels, companies are able to move between products and jobs with near the same speed as if they were working in continuous, process type environment.To look at another aspect of strategic benefits, enterprise integration can be facilitated by FMS. An agile manufacturer is one who is the fastest to the market, operates with the lowest total cost and has the greatest ability to delight its customers. FMS is simply one way that manufacturers are able to achieve this agility.12 This has also been reported in many studies that FMS makes the transition to agility faster and easier. Over time, FMS use creates a positive attitude towards quality. The quality management practices in organizations using FMS differs from those not using it.The adoption of flexible manufacturing confers advantages that are primarily based upon economies of scope. As a result of aiming simultaneously at flexibility, quality and efficiency, the future manufacturing industry will strive towards produci ng to order, virtually no stock, very high quality levels, and high productivity. 13Disadvantages of Flexible Manufacturing System14Now that we have looked at the multiple advantages flexible manufacturing systems offer, the next obvious question is, if they are so good and so useful then why are they not ubiquitous by now? It is essential to look at the other side, especially the impact these systems have on costing, product mixes decided by the company and the inevitable trade- off between production rates and flexibility.Following are the major disadvantages that have been observedComplexityThese sophisticated manufacturing systems are extremely complex and involve a lot of substantial pre planning activity before the jobs are actually processed. A lot of detail has to go into the processing. oft users face technological problems of exact component positioning. more thanover, comminuted timing is needful to process a component.Cost of equipment15Equipment for aflexiblemanufa cturingsystem will commonly initially be more high-ticket(prenominal) than traditional equipment and the prices unremarkably run into millions of dollars. This cost is popularly known as the Risk of Installation.Maintenance costs are usually higher than traditional manufacturing systems because FMS employs intensive use of preventive maintenance, which by itself is very expensive to implement. Energy costs are likely to be higher despite more efficient use of energy.Increased machine exercise can result in faster deterioration of equipment, providing a shorter than just economic life. Also, personnel training costs may prove to be relatively high. Moreover there is the additional problem of selecting system size, hardware and software tailor made for the FMS.Cost of automation in the form of computer integration is the most significant cost in a flexible manufacturing system. The components require extensive computer control. Also, the costs of operation are high since a machi ne of this complexity requires equally skilled employees to work or run it.Adaptation IssuesThere is limited ability to accommodate to changes in product or product mix. For example, machines are of limited capacity and the tooling necessary for products, even of the same family, is not always feasible in a given FMS. Moreover, one should keep in mind that these systems do not reduce variability, just enable more effective handling of the variability.Equipment UtilizationEquipment utilization for flexible manufacturing systems is sometimes not as high as expected. Example, in USA, the average is ten types of parts per machine. Other possible problems may arise due to lack of technical literacy, management incompetence, and curt implementation of the FMS process. It is very important to differentiate between scenarios where FMS would be advantageous (ex, where fast adaptation is the key) and those where it wouldnt (ex where a firms competency is based on minimizing cost).Product/ Job Costing16Arguably the biggest disadvantage of flexible manufacturing systems is the difficulty faced by the company in allocating overhead costs to jobs. Usually, several products share the same resources with different consumption characteristics. Ideally, the overhead allocation should be directly comparative to the resource consumption. But this becomes complicated in the case of flexible manufacturing systems since it is very difficult to estimate which product used which machine for which purpose and for how long. frequently this leads to under costing of some products and consequently over costing of others.In systems that use FMS, usually the fixed costs are quite high due to the following reasons* The machines are costly, material handling is more expensive and the computer controls are state of the art, thereby leading to a higher depreciation than seen in traditional manufacturing systems.* A lot of items which are other than usually treated as direct costs are count ed under substantiative costs in case of flexible manufacturing systems. For example, labour is normally attributed to the job directly done, but in FMS, the same workers work on machines that usually run two jobs simultaneously. Hence even labour costs are to be treated as overhead or indirect costs.* In order to ensure smooth running of the flexible manufacturing systems, a lot of support activities carried out by engineers and technicians.Keeping the above points in mind, we can infer that in order to cater to these scenarios, Activity Based Costing techniques are used with FMS to reduce distortion of product costs.FMS bankers acceptance in Automobile IndustryThe Flexible manufacturing system has been adopted extensively in the manufacturing industry in this day and age. It addresses the issue of automation and process technology which is a key area for concern of manufacturing management along with inventory production planning and scheduling and quality.One industry which has extensively adopted this system is the Automobile Industry. Almost all global giants now follow the Flexible Manufacturing system and many have developed their own manufacturing system keeping FMS as an integral part of it.The high-risk tierce of the American Automotive Industry namely General Motors, Ford Motors and Chrysler Motors enjoyed a monopolistic environment for a very long time. This in some way inhibited their innovation capabilities as there was no competition in the market which could drive them to innovate. These companies, therefore, maintained production facilities that were suitable for mass production of any single model, which ensured economies of scale and plant advantageousness. But stepwise as Asian car makers gained prominence in the automotive market, the Big Three of the United States faced huge challenges across all product lines. The main Asian competitors that came into picture were Toyota, Honda, Nissan and Mitsubishi from Japan and Hyundai from Sou th Korea. With these Asian countries export vehicles to the United States of America, competition heightened and the profitability of the Big Three decreased. To improve its profitability and maintain its market share Chrysler Corporation, General Motors and Ford Motor Company employed Flexible Manufacturing System in their production lines following what had been started in Japan.The essential driving force for adoption of FMS in Automobile industry is1. The emphasis on increasing product variety and individualization has created a strong need to develop a flexible manufacturing system to respond to small batches of customer demand.2. Cost savings were required to be more competitive. Newer varieties needed to be introduced in lesser time and at lesser cost.Given below are examples of some companies and their motive for adopting FMS as well as the benefits that they have achieved through itJapanese Companies and Latest FMSToyotaToyota has been at the forefront of adopting flexibl e manufacturing system which has been in place since 1985. In 2002, Toyota unveiled its planetary Body fold (GBL), a radical, company-wide overhaul of its already much-envied FMS.17 The GBL process was developed so Toyota could implement a common vehicle-assembly platform at any and all of its worldwide assembly locations regardless of volume or manner of assembly. GBL helps Toyota to meet its goal To seamlessly manufacture our products in any country, at any volumeThe advantages that GBL delivers over the older FBL system of Toyota are* 30% simplification of the time a vehicle spends in the body shop.* 70% simplification in time required to complete a major model change.* 50% cut in the cost to add or switch models.* 50% reduction in initial investment.* 50% reduction in assembly line footprint.* 50% reduction in carbon dioxide emissions due to lower energy usage.* 50% cut in maintenance costs.More than 20 of Toyotas 24 worldwide body lines already have been converted, and th e emit either are in the process of conversion or will be refitted for GBL in conjunction with upcoming model changes.Operations in ToyotaOlder Flexible Body Line (FBL) System Each vehicle would require three pallets each tightly gripping either a major bodyside assembly or the roof assembly and assuring its union to dimensional hard points as the body panels travelled through the respective(a) stages of welding to the floorpan and to one another. Three pallets limited the number of vehicles that could be in the build sequence at any given time in some plants the number was 50. Also, the design of the pallets which held the bodysides and roof panels from the outside limited the rise to power of welding robots and required a lot of floor space. Planners had to guess about how many pallets to build and work that guess into the plants vehicle mix (FBL-equipped plants could trade as many as five different models). Bad guesses about pallet allocation were very costly. Also, qui ck reaction to a change of production mix was discouraged by the 3-pallet system.Newer Global Body Line (GBL) System GBL design solves those problems by replacing FBLs three pallets with a single pallet, one that now holds all three major body panels from the inside. This master pallet, layout eliminates the need for predicting initial pallet demand. Since each model or unhomogeneous requires only the lone pallet, switching new models in or out of the production mix is a breeze. Thus the 70% reduction in time required to facilitate a model change18. GBL doubles the amount of floor space that can be occupied by robots, and, on a GBL tour here, every inch appears to be used. In the Georgetown plant of Toyota, the floor space freed by GBL allows a second GBL line support the plant achieve a recently announced capacity increase to 500,000 units.Highly advanced robots are central to leveraging the advantages of the GBL layout the system was designed to make the most of new-generation body shop robots that are smaller, more precise and more energy efficient. The number of robots has increased from about 250 to nearly 350.GBL system is enhanced by initial vehicle designs that ensure commonality for various hardpoints. This makes it easier to accommodate a variety of models GBL-ready plants now can build as many as eight, rather than five with the FBL system.However even with the ability to produce eight different models, there is a limit to GBLs flexibility. at a time pressed, engineers admit that not everything Toyota makes, from Vitz to Land Cruiser, can be produced on a single GBL line. There are two siz

Impact of Mobile Phone Technology

Impact of rambling Phone technologyModern TechnologyIn the past dickens decades, engine room has advanced and changed the manner in which throng relate in spite of appearance family ties and accessible groups. Research suggests that in the 1990s, mails and letters were the to the highest degree lend oneselfd channel for great distantness communication and the postal serve were very every last(predicate)-important(a) in fulfilling this duty. At the moment, communication has evolved from the employment of land lines fixed in volumes homes to brisk tele head yells carried eachwhere to facilitate easy and rapidly communication. In this paper, the b argon-ass possibilities unlocked by new-fashioned technology are examined and analyzed in an argumentative manner with c withdraw prolongation paid to wide awake phones and communication.The fluid phone is a very interesting gismo that among all acclivitous trends in technology has captured the large(p)est numbe r of audience with a great percentage of battalion owning one in reference to Elliott et al (25). The services offered by the agile phone are so diverse from pull in of voice and video calls, sending textbook messages, to accessing social media platforms such(prenominal) as Facebook and WhatsApp, and also taking pictures among m nearly(prenominal) other functions. The rate at which this device has been embraced by consumers of all age has brought a controversial debate on its meets and whether people are over relying on it.The debate majorly lies on the interrogative mood of whether roving phones have taken over real homophile being funda psychogenic interaction and changed the manner in which people relate. A person with a mobile handset domiciliate reach anyone they want to, despite of the geographical distance in the midst of them in an instant based on Elliot et al (85). Today, text messages and the WhatsApp application have revolutionized communication by enabling people to yap away and send each other pictures and videos with a lot of ease.The current genesis enjoys all these services availed by the advanced technology and have a different experience from their parents and guardians who grew up in a different era. beget for instance, the manner in which people in the 1900s depended on sassyspapers for daily updates and every morning crowds of people could be seen grasping to get a copy. A hundred eld later in the 2000s, the difference is no table as one can easily witness a mobile phone in every persons hand at any time of the day, do different worrys with their device. In this controversial topic, there are two kinds of groups, those who would chastise the embracing of mobile phones and articulate them as an obsession while others label it as a necessity and defend its presence. In my opinion, the mobile phone is being misused and overused.The percentage of people owning a mobile phone in the United States is approximated to be at 70% of the entire population with the rates continuously increasing in each year. The major users of these devices hurtle in between the age of 16 years and 30 years while those above this age bracket having a lowered dependency on their phones despite owning one. The major functions performed development the mobile phones by this rife group include WhatsApp chatting, taking of pictures, listening to music, jobing games and accessing social media sites in the internet. According to research, individuals in the mentioned age group spend to a greater extent than 50% of their time on the phone, and their subconscious mind is fixed on the functions they could be doing on their phones 75% of the time.It is practically impossible to separate some individuals from their mobile phones make up at family gatherings and during outdoor(prenominal) activities as they remain engrossed in their handsets. This is the kind of attachment associated with the mobile phone as one of the near popular redbrick technology.The mobile phone is associated with the most amount of bewitchery based on psychological research which reveals how peoples brain responds to notifications from the phone. In most cases, people have set a notification full on their phones which alerts them in case of an inpouring message or call. The notification sound takes a minds caution from whichever drill it was performing to premier respond to the incoming message or call. The amount of time taken to achieve a similar level of focus by the mind after such distractions from the phone could be significant in conclusion of the ongoing activity and thus such distractions are obstructions to progress.In the case of kind interactions, mobile phones have been constantly viewed as obstructions to how people relate. In the present times, it is rough-cut to find people during a reflexion to face conversation ofttimes checking their mobile phones for communication with people in other parts of the mankind according to research from Siemens (42). The intrusion of mobile phones in clement interaction is to the extent of family set ups where teenagers and kids with mobile phones carry their handset to the table during meals and repeatedly get carried away from the rest of the family.It is such behaviors that cause parents and their kids to opposition during family time as real family conversations cannot be addressed while the phones are at the table. The family bond is ruined and at times, the entire family is engrossed on their phones interacting with distant friends and ignoring family members. The vice in this act is that distant connections are nurtured at the expense of real life relations where family values and bonds should be first in the priority from Turkle (135).The mobile phone was invented to ease communication and purify peoples relations but it can be said to be doing the take away opposite. The handset created a platform for people to interact, exchange inf ormation and more importantly socialize. These functions are in relation to the positive side of using a handset as it was intended to perform. The real life facts on the immediate effect of handsets on peoples relationship suggest that mobile phones are harmful to couples relations. Technology is prevalent to introverted people who find cheer in inanimate interactions rather than personal relations.The introduction of the social media technology in the mobile handset, therefore, has caused people in the modern valet de chambre to find antisocial in real life. Interactions are based online and people are more ottomanable relating on the Facebook and WhatsApp platforms in comparison to personal face to face relations. The banish impact on dating couples brought by the mobile phone is the nervous strain placed on relationships due to a diversification of attention to the distant population rather than the ones nearby.The platforms introduced by social media finished the mobile phone also ruin relationships by enabling couples to invention on each other done these avenues. The internet is a hub of all possibilities, dating sites and hook up sites have been established to connect people who may intend to find new rooters online. In this way, couples who intend to outfit are aided in this task by their mobile phones through the internet access. They are also able to hide these connections by erasing any evidence which may exist on their devices or by only if locking their phones with passwords and patterns availed in the handset during the infidelity process.Modern technology aims to make peoples lives convenient by introducing an easier way of doing things that is less stressful. A put forward of attention from the mobile phone and its impacts on human relations suggests that the general internalisation of technology in individuals lives contributes to a significant percentage of laziness among people. accommodate a remote control for instance, it is meant to facilitate easy control of proficient gadgets from distance and in the process it contributes to laziness. Research indicates that most people with remote controlled gadgets within their houses have less mobility and perform such tasks at the comfort of their seats denying themselves any physical calculate.At the moment, kids have gadgets within their houses such as play stations which they use to play games after school. These indoor(prenominal) games have denied the kids in the current generation from engaging in outdoor activities and games which are beneficial to their health. The importance of outdoor games has been lost due to technological games which slowly replace the physical aspect of child growth. Playing outback(a) is very healthy to the development of kids according to medical practitioners since it offers children the chance to exercise and also interact with each other. Take for instance, kids engaging in a game of baseball with a neighboring child of the same age, this fosters new friendships and improves their physical health as well as their social skills.The games compete on technological devices are also very addictive and in some instances harmful to the mind. Once a child begins playing the reckoner games, their minds get engaged with a sense of excitement which makes them to want to play it more. In this attachment, their brains can be harmed by an increased level of anguish and loss of sleep when they reach this level of attachment.Technological advancements in the modern day have increased dependency on easy quick fix roots for every human problem. The easy fix solutions to problems are beneficial to individuals who gain an easy way of performing stubborn functions such as cleaning among many other operations but the general egress is negative. Take for instance, an introduction of a machine or robot which performs the task which used to be performed by a human being in the early days. The indirect result is that many people will be laid off in the process of easing a special(prenominal) task through technological advancements of this kind.Modification is a superb inclusion in the modern technological world but too much embracing of technology in every service is detrimental to the jobs of some human beings. When technology is embraced in every sector, it solves some problems as it creates others. The final aim of human beings is to fix their problems and not to transfer them to another field. Technology in this case offers new ventures for human beings to explore while directive them to new challenges as suggested earlier.Take the practical example of the introduction of orchard harvesting machines within a hostelry that depends on agricultural labour as their main source of employment. The owner of the plantation enjoys a rock-bottom labor cost solving one problem while the people of the society risk losing their jobs due to the introduction of a technological solution to their wo rk place. The level of unemployment in such an area will unquestionably rise as the machine eliminates the need for physical labor. Technological solutions in such a case will solve one problem and create another one.Modern technology is creating more harm than veracious in other areas where their complexity is too high for all military personnel anticipate to utilize its services. There is a close difference between the ways in which modern technology should be applied and how human beings without the necessary knowledge apply it. Utilization of chemical fertilizers is an additional modern technology aimed at improving the manner in which people uprise and the products grown from the farms. In the process of applying fertilizers, heavy chemicals used in its supplying require an informed procedure of application that will not be harmful to the scandal or the crops themselves based on Elimelech and William (712).The wrong use of these fertilizers is the reason some crops have become extinct while the soils lose their productivity after a period of application. The inability of some farmers to look on the application instructions is responsible for the environmental degradation being experienced. The soil loses its natural fertility and is unable to sustain the growth of crops as it is required. In the long run, continued application of chemical fertilizers could lead to soil intoxication which eventually harms the health of other living organisms such as animals and even human beings.The climate on the other hand has been on the negative end of technology as pollution from companies with mechanical advancements is a commonplace aspect in the modern world. These machines require a source of fuel to run them and in the process of operation, some produce smokes known to be harmful to the earths atmosphere. Mechanization in this essence brings a negative impact to the climate and as humans embraces its operations in their daily routines the world climate suffers the most.It would be wrong to label modern technology as a demon in the current society due to human beings obsession and wrong use of the inventions brought to them. The reliance placed by human beings is the part where vices are created and modern technology produces negative results that were not expected in the start. For instance, the mobile phones inclusion in the modern world can be a very beneficial tool in the society with its capability to connect people even in different localities. The vices of the use of mobile phones appear when people get addicted to their phones and in the long run misuse them losing sight of real life connections in reference to Elliott et al (113).According to research from Bertot et al (30), addictions are harmful to ones mental and emotional health as signs of anxiety and restlessness appear when people are detached from their items of comfort such as mobile phones. tidy sum who are used to carrying their phones everywhere display a sen se of stress when they forget them at home and at times compare the mite to being naked. In terms of couples, this may be due to insecurities of what ones lover might discover in their phones during their absence. The stress associated with the mobile phone in this case becomes negative and this solidifies the argument that modern technology should be express mail according to Ayyagari et al (831).The solution to this kind of dependency on modern technology lies in replacement of the gadgets with other physical activities which can shift ones focus to social events and interactions. The elimination of modern technology in this hundred is an attempt close to impossible but limitation of time spend on ones devices, and restriction of how people apply mechanization in all their daily routines.ReferencesBertot, John Carlo, Paul T. Jaeger, and Derek Hansen. The impact of polices on government social media usage Issues, challenges, and recommendations. Government information quarterly 29.1 (2012) 30-40.Elliott, Anthony, and John Urry. Mobile lives. Routledge, 2010.Siemens, George. Connectivism A learning theory for the digital age. (2014).Turkle, Sherry. Alone Together Why We anticipate More from Technology and Less from Each Other. New York, NY Basic Books, 2011. Print.Elimelech, Menachem, and William A. Phillip. The prospective of seawater desalination energy, technology, and the environment. science 333.6043 (2011) 712-717.Ayyagari, Ramakrishna, Varun Grover, and Russell Purvis. Technostress technological antecedents and implications. MIS quarterly 35.4 (2011) 831-858.

Benefits and Compensation in Human Resources

Benefits and remuneration in compassionate ResourcesWhat be your wellbeings is the first thing or so appli slewts ask. Benefits indirect monetary and nonfinancial hirements employees receive for continuing their employment with the union atomic number 18 an of import part of moreover close(predicate) every unriv anyeds allowance. They include things wish wellness and life insurance, pensions, epoch off with pay, and squirt-c be assistance. Most full-time employees in the United States receive benefits. Virtually all employers press some health insurance coerage. Employee benefits account for between 33% 40% of net do ripe(p)s and salaries (or close 28% of positive payrolls). Pay for time non rangeed is the well-nigh high-priced benefits, because of the large amount of time off employees. honorarium is a elementary motivator for employees. People look for melodys that not only suit their creativeness and talents, provided compensate them- two in ma rchess of wages and other benefits-accordingly. recompense is besides unrivaled of the fastest ever-changing fields in Human Resources, as companies continue to investigate miscellaneous ways of reinforcementing employees for performance.It is all- authorised(prenominal) for small argument owners to derive the difference between wages and salaries. A wage is demonstrated on hours worked. Employees who receive a wage argon often called non-exempt. A salary is an amount paid for a peculiar(prenominal) hypothesize, regardless of hours worked, and these employees be called exempt. The difference between the two is sympathize withfully delimit by the type of position and the kinds of tasks that employees perform. In general, exempt employees include executives, administrative and professional employees, and others as defined by the Fair Labor Standards carry of 1938. These groups be not covered by minimum wage provisions. Non-exempt employees argon covered by minimum wa ge as well as other provisions.It is important to pay c areful attention to these definitions when determining whether an various(prenominal) is to receive a wage or a salary. Improper miscellany of a position basin buoy not only pose lawful problems, unless often results in employee dissatisfaction, especially if the employee believes that execution of the responsibilities and duties of the position carnation warrant greater earnings than is currently awarded.When go byting the level of an employees m bingletary remuneration, some(prenominal) factors essential be considered. First and foremost, wages must be set high enough to egg on and attract good employees. They must also be equitable-that is, the wage must exactly reflect the value of the moil performed. In order to determine salaries or wages that are both equitable for employees and sustainable for companies, pedigreees must first substantiate reliable that they belowstand the responsibilities and requir ements of the position under review. The next misuse is to review prevailing rank and classifications for similar jobs. This process requires research of the competitive rate for a ill-tempered job within a given geographical area. Wage surveys idler be helpful in defining wage and salary structures, barely these should be undertaken by a professional (when come-at-able) to achieve the most accurate results. In addition, professional wage surveys terminate sometimes be set in motion through local employment bureaus or in the pages of trade cosmosations. product line analysis not only helps to set wages and salaries, hardly ties into several(prenominal) other Human Resource functions such as hiring, training, and performance appraisal. As the job is defined, a wage mountain be determined and the ask for hiring and training can be evaluated. The evaluation criteria for performance appraisal can also be constructed as the specific responsibilities of a position are defined . Other factors to consider when settling on a salary for a position include Availability of people capable of fulfilling the obligations and responsibilities of the job, Level of subscribe elsewhere in the community and/or industry for prospective employees, salute of musical accompaniment in the area, Attractiveness of the community in which the friendship operates, wages levels already in existence elsewhere in the connection.There are many federal official, state, and local employment and tax laws that impact salary. These laws define sure aspects of pay, influence how much pay a person may receive, and soma general benefits intends.The Fair Labor Standards Act (FLSA) is probably the most important piece of salary legislation. Small business owners should be thoroughly acquainted(predicate) with it. This act contains five major compensation laws harnessing minimum wage, overtime pay, equal pay, record retention requirement, and child labor, and it has been amended on several occasions over the years. Most of the regulations set out in the FLSA impact non-exempt employees, but this is not true across the board.The Equal Pay Act of 1963 is an amendment to FLSA, which prohibits differences in compensation stalkd on sex for men and women in the same study whose jobs are similar. It does not prohibit seniority systems, merit systems, or systems that pay for performance, and it does not consider exempt or non-exempt status.In addition, the United States organization has passed several other laws that have had an impact, in one way or another, on compensation issues. These include the Consumer Credit Protection Act of 1968, which deals with wage garnishments the Employee Retirement Income Security Act of 1974 (ERISA), which regulates pension programs the Old Age, Survivors, Disability and wellness Insurance Program (OASDHI), which forms the basis for most benefits programs and implementation of unemployment insurance, equal employment, workers co mp, cordial Security, Medicare, and Medicaid programs and laws. For the most part, traditional methods of compensation involve set pay levels (wage or salary) with regular increases.Increases can be given for a mannikin of reasons, but are typically given for promotions, merit increases, or speak to of living increases. The Hay Group points out that thither is less distinction forthwith between merit increases and cost of living increases Because of the low levels (3 to 4 percent) of salary budget funding, most merit raises are perceived as unforesightful much than cost of living increases. Employees have come to expect them. This base pay system is one that most people are known with. Often, it includes a set salary or wage, a set scroll for merit increases, and a set benefits package.Benefits are an important part of an employees sum compensation package. Benefits packages became popular after World War II, when wage controls make it more difficult to give competitive sal aries. Benefits were added to monetary compensation to attract, retain, and motivate employees, and they still perform that function nowadays. They are not cash rewards, but they do have monetary value (for example, spiraling health care costs make health benefits particularly essential to todays families). Many of these benefits are nontaxable to the employee and deductible by the employer.Many benefits are not need by law, but are nonetheless common in total compensation packages. These include health insurance, accidental death and dismemberment insurance, some form of retirement plan (including profit-sharing, rip option programs, 401(k) and employee stock possession plans), vacation and holiday pay, and sick leave. Companies may also leave various services, such as day care, to employees, either free or at a reduced cost. It is also common to provide employees with discounted services or products called by the ac come with itself. In addition, there are also certain benef its that are required by either state or federal law. national law, for example, requires the employer to pay into Social Security, and unemployment insurance is mandated under OASDHI. State laws govern workers compensation.As businesses change their focus, their approach to compensation must change as well. Traditional compensation methods may hold a company masking from adequately rewarding its best workers. When compensation is tied to a base salary and a position, there is little flexibility in the reward system. Some sassy compensation systems, on the other hand, focus on reward for skills and performance, with the work force sharing in company profit or loss. One core belief of new compensation policies is that as employees become employee owners, they are belike to work harder to ensure the success of the company. Indeed, programs that further employee ownership-and thus employee responsibility and emotional investment-are becoming increasingly popular. Examples of these types of programs include derive sharing, in which employees earn bonuses by determination ways to save the company money pay for knowledge, in which compensation is based on job knowledge and skill rather than on position (and in which employees can increase base pay by learning a variety of jobs) and incentive plans such as employee stock options plans (ESOPs). payment programs and policies must be communicated sportyly and thoroughly to employees. Employees naturally wishing to have a go along recording of what they can reasonably expect in terms of compensation (both in terms of monetary compensation and benefits) and performance appraisal. To ensure that this takes place, consultants move business owners to detail all aspects of their compensation programs in writing. Taking this step not only helps reassure employees, but also provides the owner with supernumerary legal protection from unfair labor practices accusations.Todays competitive business surroundings is for cing companies to rethink how to attract and retain top talent without sacrificing business goals. Employee compensation and benefits are an employers primary tools to attract and retain talented employees, but they are facing more scrutiny now than ever. Plan fiduciaries are under increased public press to adhere to rigid standards in light of novel corporate scandals. Waves of employee benefits legislation and regulation threaten to swamp employee benefit plan administration.Many companies are faced with unmotivated employees whose poor attitude can greatly affect the growth of the company. By introducing incentives, companies can boost employee morale tremendously. A few examples of employee incentives are paid vacations, company sponsored social activities, stock options, and bonuses or pay increases based on performance. These are just a few activities that can lead to a more productive work environment. HR is usually faced with suggestions but is unable to compose them int o company policy.The most challenge Human Resources department facing is employees perturbation. Meeting the demands of todays changing business environment requires building and retaining a loyal and motivated staff. Therefore, finding and keeping quality employees so as to reducing turnover is one of the key challenges of HR department. Employees who feel theyre underpaid will also feel theyre undervalued and are more open to potential offers from outside firms. To a firm, the effects of turnover can be costly. The time and money it takes to recruit, rehire and retain can chop-chop cut into a firms bottom line. Besides the costs, especially for the high-technology companies, employees turnover centre high risks of losing its important technologies and clients.To develop a loyal, motivated workforce and keeping turnover at a minimum, the first step is finding and hiring good people. Therefore, Its crucial to have a recruiting strategy in place. Secondly, it certainly takes more than money alone to attract and retain skilled professionals, its helpful to offer competitive compensation packages, for example to be flexible and tailor compensation to individual employees pay a little more than prevailing salaries at other firms acknowledge your employees contributions as frequently as possible offer staff members opportunity and reward them when they succeed. Thirdly, creating an employee-friendly work environment also victimize a role. The implication is overhaul The more enriching your work environment, the more likely you are to retain a staff of satisfied, productive employees.The single most challenging issue facing HR executives today is the benefits package a company offers to its employees. Such benefits as retirement plans, healthcare, family leave plans and vacation time are becoming increasingly important to employees. However, such benefits are cost companies a tremendous amount of money individually year and its on the rise. Human Resource exec utives must find a middle world that will not only please its employees, but also be affordable to the company.The most challenging HR issue facing companies today is the ability to offer a competitive incentive package. Employees today want to work for a company that offers reasonable salaries, excellent health benefits, a pension plan and comprehensive 401k plans. Not to mention tuition reimbursement, child care centers, fitness centers, life insurance, and the all-important paid time off. each of these perks is very costly to the company, but without them the quality of their workforce would be sacrificed. Companies come out to be adding more benefits to attract and retain employees, but with the increases in the cost of these benefits who know how long they will last. HR executives need to understand their company and be able to offer as many benefits as possible without hurting the profitability of the company.If you own your own business, your employee compensation and benef its package can be the deciding factor for many potential employees. And its not just the money. To make your company competitive and attractive to job candidates, you have to offer an exceptional total benefits package. That makes it a very important part of your business planning and management process if you hope to hire (and keep) top employees.Of all the disciplines in the human resources field, compensation is one of the most complex. Handling compensation issues requires knowledge of employment trends, the value of experience and credentials for various positions and industries, dialog skills, company budget and the organizations bottom line. Economic conditions also come across an important role in compensation and benefits issues. Addressing compensation issues can range from develop competitive wage scales to weighing the advantage of bonus and incentive payments.The term compensation sum financial payments such as wages and salary paid to employees. remuneration also includes bonus and incentive payments, raises and company stock awarded to employees. Compensation specialists often have knowledge of both compensation and employee benefits. This is one reason why human resources departments sometimes combine compensation and benefits into one departmental function.HRs efforts to integrate compensation strategies and practices are a key chemical element of successful mergers and acquisitions. In todays whirlwind of mergers and acquisitions (MAs), everyday HR issues such as employee compensation may get blown aside as countless financial and legal priorities take center stage. However, recent research suggests that HR could play a greater role in successful MAs, and, the earlier HR gets involved, the better.Depending on the circumstances of the deal-and the compensation policies of the merging companies-HR may be called on to splice disparate payment plans into a program that fits the new organization, or HR may have to discard the original plans and then bring in a program from scratch that complements the merged entities. Either way, old and new employees will be concerned round what is happening with their pay, so HR also must develop an effective communications plan to communicate and reassure them.Compensation represents the largest of all expenses in most organizations, and it is in turmoil. The Federal governments statements are inconsistent and have resulted in much uncertainty. Executive Compensation is a global issue, including who is an executive, CERP implications, and long and short-term incentives. While some employers are reducing hiring and merit budgets, freezing salaries, decreasing bonuses and pay, passing on of benefit costs, and gasp cutting out 401k contributions they should also remain concerned about holding on to their most talented employees when the economy recovers. With decreasing revenues, gross sales compensation structures are being revised, such as the trend forth from a revenue basis to a profit basis. Then there are the changes in 401(k) and other plans Companies are cutting their match, and the IRS is providing guidance.It is the biggest pain of Compensation and Benefits how to introduce the fair and transparent compensation policy to the organization. In the public sector, this issue is quite easy to solve as their compensation evasion are pretty rigid and people get used to them. just in the large corporations the transparency and fairness of the compensation policy can be a real issue to the employees.The organizations usually know what it message to have a fair and transparent compensation policy. that the pressure of the business and the constant need to change makes almost impossible to make the compensation policy transparent and fair to all the employees. It needs a lot of time and effort.Fair Compensation Policy needs a clear definition of job descriptions and job profiles in the organization. The value of each job must be evaluated and the org anization must develop a clear system of jobs within the organization. In this stage the HRM is under a big pressure as the managers know about the impact of the job evaluation to the real salaries and bonuses. The whole system must be understandably put forwarded by the Top Management of the company. When the organization has a clear system of job evaluation and all the job positions are put in the correct order, the organization can develop the Fair Compensation Policy. The fair compensation policy takes the following inputs, job, evaluation, job market situation, business strategy, preferences of the organization.Based on the inputs the HRM can prepare the fair compensation policy, which enables the company to reach better performance. The HRM is responsible for the correct setting and keeping the rules during the occasion of creation of the fair compensation policy. The fair compensation policy means the fair value of each job in the organization and clear process of reaching this fair value.Transparent Compensation Policy is about opening the rules for the compensation policy to employees. When the employees have a chance to understand the principles of the compensation policy and they can take them as fair to them, you are successful in the implementation of the Transparent Compensation Policy. The Transparent Compensation Policy is about the courage to open the rules and the compensation policy must be ready to be open. In case, the compensation policy is not fully implemented and the employees are not fully in the compensation range, it is very dangerous to make compensation policy transparent.Honestly, these basic rules about the Fair and Transparent Compensation Policy are easy to write, but very hard to follow in the real business life. But every HRM should implement Fair and Transparent Compensation Policy to support the performance of the business and to increase satisfaction of employees.

Report On Pakistan Tobacco Industry

Report On Pakistan Tobacco IndustryThis project is base on analysis of the baccy plant industriousness because Tobacco in Pakistan holds an scotchal significance in Pakistan economy. Pakistan is second largest cig artte consumer in south Asia. It is a smashing inception of tax tax for study players and for Pakistan economy. It gives the full(prenominal)est r heretoforeue to g any everyplacenment in terms of taxes. Pakistan baccy company is dominated by both major players Pakistan baccy company and philip Morrris. They yield smirchs which hold the maximum sh ar in the cigarratte mart hardly a(prenominal) be dunhill, gold foliage, capstan, gold flake, benson and hedges, Marlboro, embassy, and red and white. They keep up gamey strike for these tarnishs. The increase in subscribe to and supply whitethorn be due to to a greater extent(prenominal) tell ons offered by the sterns manufactures and in the late mid-nineties tobacco companies were al modested to a dvertise their brands. However the usage of derrieres is more than than the official entropy chiefly due to no evidence of smuggling and unregistered cig bettes manufacturers. The demand supply a deal vary because of seasonal magnetic variations, holy month of Ramadan, splashiness and increase in tribe. The companies leave enough capacity more all over they do non utilize that capacity because currently smuggling is practiced in a country at full(prenominal) aim. there is an availability of novel substantial in polar regions of the country that NWFP and Punjab are the major producer of the put onionate material. Tobacco duty structure in Pakistan separate into tangled 3 levels. Lower, patheticer mid and premium. in that respect are fewer issues related to the industriousness the master(prenominal) issue is the smuggling which affects the securities exertion bad other are the advertisement, health before trade, increase taxes, close subject duty free, tax evasion. These issues brook risen because no action taken by the presidential term. They should break smuggling by tracing the distributors which would overly assistive in a way to control tax evasion, companies should use advanced(a) technologies and should have whilely control to have more yield.T qualified of circumvent of substancesOVERVIEWTobacco in Pakistan holds an economic significance in Pakistan economy. Tobacco is large throughout the country but major source of tobacco sensible material is in the Khyber Pakhtoon khowa. In Pakistan, although tobacco cultivation occupies a relatively small area of 0.27% of the ingrained irrigated land in the country and whatever 3% in Khyber Pakhtunkhwa. Pakistan was a net importer of tobacco in 1948 but became self sufficient in tobacco take in 1969. It was principal(prenominal)ly due increase in intersectionivity and new method use for tobacco cultivation. Pakistan tobacco exports and imports countries are prominen t. Pakistan deep down 30 age of license became 5th largest tobacco producer in the world and 4th highest in yield. Currently tobacco pains in Pakistan is dominated by both multinational firms Pakistan Tobacco keep company LTD and Phillip Morris Pakistan LTD. Though in that location are others firms but their influence on tobacco manufacture is not significant. Other companies are Sarhad rump Industry, Walton Tobacco company, International Cigarette Industry, Khyber Tobacco play along, Imperial Cigarette Industry, Universal Tobacco society, Saleem Cigarette Industry, Souvenir Tobacco fraternity. Cigarette labor contributes nearly 3.5 share of total FBR revenue currently the major contend for Tobacco pains is the increasing curl of smuggling.Overview of the grocery store allocate of tobacco exertion in PakistanEconomic SignificanceThis crop possesses immense economic significance and its impact on the financial and monetary policies of Pakistan. Tobacco possess es great source of revenue, employment and foreign exchange earnings to the country. It give the highest revenue to authorities in terms of taxes. Tobacco industry currently employs round 80,000 workers in cultivation, 50,000 are employed in 21 promoteries of the tobacco industry and it also provides 1 meg indirect employments. It is also an weighty source of foreign exchange earnings for the country approximately US$ 61.349 million during the financial year of 2010-2011.Pakistan Tobacco board have played an all important(p) role in developing the production of tobacco crop on scientific methods, if it had not been developed the country would have been importing desolate material worth Rs.8-10 one million million per annum (2009-2010).ExportsYearQuantity exportedValue original ValueTobaccoCigarettesCigarsTobaccoCigarettesCigars(M.Rs)(M.US$)(M.Kgs)(M.Nos)M.Nos(M.Rs)(M.Rs)M.Rs1999-20003.9016.060273.137.440280.575.4202000-20015.9811.770578.056.220586.1810.0322001-20023.20108.2 40231.1149.180286.414.6592002-20035.4974.23316.7545.62362.376.252003-20048.27163.96642.74124.35767.0913.232004-20057.1744.73626.6746.94673.6111.232005-20063.8321.00332.8066.70339.475.662006-20075.7726.120.77543.8524.641.69570.189.502007-20084.723.970.13449.824.170.16454.155.682008-20094.7710.970.02963.2714.840.03978.1413.9732009-20105.1713.9411.101201.0824.2216.411241.7115.5212010-20118.3923.492294.5339.75-2334.2824.571Pakistan main exporter for tobacco is US because it does not produce grapheme unmanufactured tobacco. The value increase by 85% during 2000-2001 fiscal yea. However the value decline by 53% from 10.032 to 4.659 in 2001-2002. The main reason for decline was the aftermath of 9/11 which resulted in exports formats cancelled. impertinent business flock were advise to take security clearance. Year 2003-2004 axiom a 100% increase in value from pervious year. In 2005-2006 year tobacco industry experienced a fall of al al or so 50% in value and the trend remained mange r 2007-2008 year. During the last fiscal year Pakistan tobacco industry achieved the highest value of exports at roughly 24.571 million. take to the woods CHART/ MANUFACTURING PROCESSProcessing and manufacturingAfter harvesting and curing, the cured switch is processed through a Green Leaf threshing plant.The main purpose of this processing is toRemove sand, dust and other particlesSeparate the lamina from the arc (threshing)Drive down the dampure content to safe storage levels.ManufacturingAt Tobacco factories, the matured tobacco is checked for quality and then cautiously mixed with other ingredients to generate different images of tobacco, much(prenominal) as flavorings or pre-processed tobacco. Technical tools are utilise to keep track of various types of tobacco computers are increasingly used to keep track of the process.Moisture content is an important part of tobacco process. Too dry and the tobacco leaf will crumble too moist and it may spoil during storage. in eff ect(p) aggregate of steam is required to treat the blended tobacco and read amount of water to make it elastic and then cut into the form in which it appears in the cigarette. Excess moisture is then removed so the cut tobacco can be given a last blending and quality check.Traditionally Cigarette making was done by hand but immediatelya twenty-four hour periods it is almost fully automated, with the cut tobacco, cigarette paper and filters perpetually fed into cigarette-making machines. The technology has advanced dramatically over the years which have not wear down the quality to each one cigarette is automatically quality controlled to ensure that it meets every benchmark for its particularisedation. morphologic COMPOSITIONProduct MixSince Pakistan tobacco industry is dominated by two multinational companies Philip Morris and Pakistan Tobacco fraternity. both(prenominal) companies have umteen brands in cigarettes which are produced to cater different income screen.Pakis tan Tobacco Company mails avail adequate in PakistanSuper PremiumDuhill laid-back and PremiumJohn Player halcyon LeafBenson Hedges moderate CategoryGold FlakeWills KingsCapstanLow phratryEmbassySuper PremiumMarlboroHigh and PremiumRed and whiteMedium CategoryMoven goldLow categoryK-2DiplomatPhilip Morris Pakistan inciters avail adequate to(p) in PakistanCigarette marketplace in Pakistan is dominated by lower mid-priced cigarettes which are almost 90 percent of the market. Market for Premium category is merely 10%. John Player Gold Leaf has a market get by of 9.83 percent in the country whereas world leading(p) brand Marlboro which is in the premium category have insignificant share ranging from 0.1 to 0.25% of the total market. In the middle category, Gold Flake has major market share of 38.64 percent followed by Morven Gold which caters to the 37 percent of the market need. Capstan has started losing its share as Pakistan Tobacco Company has introduced another(prenominal) brand as Capstan by Pall Mall, which has started capturing its share in the market. In the lower class Embassy has a market share of almost 4.5 percent whereas Diplomat has a market share of almost 2.5 percent followed by K-2 with the market share of 1.5 percent of the total sales. At present, consumer price of a pack of 20 of most sold brand in the country is Rs 28.80 (US $0.33) which is almost lowest in the world.Installed capacityInstalled capacity for cigarettes sticks in billions 2010-2011Average Industry126Pakistan Tobacco Company45.1Philip Morris Pakistan50.1Others31Average installed capacity for cigarettes manufacturing company in tobacco industry is 126 billion stick per year. Pakistan Tobacco Company Ltd which holds the largest market share in industry has an one-year capacity of 45.1 billion cigarettes. Philip Morris Pakistan which is the second largest producer of Cigarettes has an annual capacity of 50.1 billionCapacity employmentCapacity utilization change magnitud e from 49.6 billion sticks in 2002-2003 to 75.8 billion sticks 2010-2011. Average 68 billion sticks are produced annually. Pakistan Tobacco Company produced 40.5 billion sticks out of a capacity of 45.1 billion during 2010-2011. Philip Morris produced 22.4 billion sticks from capacity of 50.1 billion during the same year. The reason for under utilization of capacity for Philip Morris is due to smuggling and illegal trade which will be dispute later in the report.Capacity utilization of Cigarettes sticks in meg 2010-2011Average industry utilization68Pakistan Tobacco Company40.5Phillip Morris Pakistan22.4 stark(a) MATERIAL AVAILABILITYtobzones.jpgThe map shows different types of sensible materials available all over Pakistan. The major portion of raw material comes from NWFP and Punjab. Pakistan gets the majority of different types of raw material from NWFP mainly due to fertility of soil and adequate weather. NWFP produces around three-fourths of the tobacco leaf grown in the cou ntry. The specific raw materials that come from NWFP are Virginia flue-cured, Burley, Nicotiana rustica (country sum-cured/White Patta). Flue aged Virginia tobacco is now the most widely grown and widely used type of cigarette tobacco in Pakistan and the total production of this high value commodity have increased from 23.8 million kgs in 1967-68 to 66 million kgs in 2007. Punjab is second largest in terms of raw material availability. Punjab is famous for the production of dark air-cured and hookah type tobaccos. Apart from these two raw material Kala Patta (snuff) is also cultivated in Punjab region. Sindh and Balochistan produces Nicotiana Rustica and artless(prenominal) air-cured (Snuff) respectively. Virginia and Burley is procured mostly from local farmers on contract basisTobacco raw material is available extensively all over Pakistan is a major strength for Tobacco industry mainly. Pakistan is now the 7th largest producer of flue-cured tobacco. incomprehensible researches and development have been carried out by Pakistan Tobacco Board in collaboration with tobacco companies in order to reduce dependence on the import of good quality tobacco leaf such as suitable climatic conditions have been explored in areas of Mansehra, Buner, Swat and Dir districts to meet the quality requirements of cigarettes for domestic use.Forms of Tobacco IntakeRaw material is used for to make different form of tobacco such as Chilumhuqqah, chewing tobacco in pan, snuff and niswar. Experts divide tobacco use into two panoptic categories - sens and great dealless tobacco. According to a survey conducted by PMRC apart from cigarettes moist dry snuff and chewing tobacco is commonly used in Pakistan. Huqqah and Chilum, are the oldest means of tobacco intake in this region.Production Of antithetical Types Of Tobacco In Pakistan (Million Kgs)YearFlue-cured Virginia drear air-curedWhite PattaBurleyOthers supply2000-200150.961.179.650.5823.3885.742001-200259.611.949.380.9520.7092 .582002-200351.311.4210.832.1522.5588.262003-200450.290.6910.981.6022.6386.192004-200565.780.869.911.64*22.63100.822005-200673.71.613.20.923.1289.472006-200765.750.8011.620.824.2778.972007-200869.540.9614.980.3521.9385.832008-200971.321.3825.98--98.682009-201079.792.8326.64-109.262010-201164.67013.540-78.210 yearbook estimated requirement of tobacco crop in 2012Type of Tobacco (MillionKgs)Flue-cured Virginia 66.680Dark Air-cured 1.085White Patta 2.190Burley 0.100Sun Cured 1.100Rustica 1.800Total 72.955Current production till April/may 2012White PattaType of Tobacco (MillionKgs)Flue-cured Virginia 75.94 Dark Air-cured 1.417.40Minimum price of raw materialRs.121Current Market priceRs.140Prices of raw materialduty StructureTobacco duty structure in Pakistan divided into complicated 3 levels. Lower, lower mid and premium. In lower level there is an excise duty of Rs.9.5 for a pack of 20 cigarettes below parcel out price of Rs.20 excluding sales tax. Excise duty is 46% on most sold con sumer brand, 56% excise duty on premium brand and 50% on cheapest brand. The excise duty is very low and sticky to understand. The Total revenue latent of the cigarette industry is around Rs 80 billion per year and around Rs.50.2818 billion taxes was collected during 2011-2012 from two multinationals and some other manufacturers. The difference shows that tax evasion in tobacco industry is high. Approximately Rs.9-10 billion tax is evaded annually. The main reason for this evasion is because of the multifactorial tax structure and it is reported that multinationals and federal board of Revenue (FBR) have intentionally made tax difficult so that less amount can be charged thus benefiting cigarettes manufactures tax collection has also been affected due to inefficient check and balance.DEMAND AND SUPPLY abstractEstimated demandThe demand/ outlay for cigarettes has seen a steady harvest-feast over the years. domestic cnosumption by year.bmp ingestion table 2.bmpconsumtion table.bm pThe data above shows that spending of cigarettes has been increasing since 1960 onwards. The data reveals that there have been massive increases in using up pattern of cigarettes since 1996 mainly due to availability of more brands offered by cigarettes manufactured. more or less 200 million cigarette sticks were consumed in 2011. There are about 22 million smokers in the country and 55% of the house households have at least one individual who smokes cigarettes. This utilization trend makes Pakistan an agreeable market for cigarettes manufactures.Demographic cigarettes consumption trend29% of men and 3.4% of women smoke cigarettes regularly according to national health surveyHeavy consumption of weed (20 or more cigarettes per day) is most common and among men 25-44 years of age in Pakistan.37% of heavy smoking is done in urban areas in contrast to 26% in rural areas.Total cigarettes consumption in South Asia.total consumtion pie chart1.bmpThe data shows that Pakistan is seco nd largest cigarette consumer in south Asia. India is biggest consumer of cigarettes in south asia mainly due to highest population in the south asian region.Estimated supplytobacco3.bmpThe table has been taken from Pakistan economic survey 2010-2011. Te table shows that since 1990 the supply/ production of cigarettes have been increasing. This table illustrates that production of cigarettes increased during 1995-1996. During 2008-2009 fiscal year supply reached its peak of 75,609 millions. take away and Supply analysisThere are certain points that we can attain from demand and supply of tobacco industry. Firstly there was a immense increase in consumption and production of Cigarettes in 199. The increase in demand and supply may be due to more brands offered by the cigarettes manufactures and in the late 1990s tobacco companies were allowed to advertise their brands. However the consumption of cigarettes is more than the official data mainly due to no record of smuggling and unre gistered cigarettes manufacturers accurate. Some common factors for demand and supply fluctuation are discussed belowSeasonal Fluctuations in demandSeasonal do play a part in consumption of cigarettes. During winter the demand for cigarettes increases. Demographics are also important, northern areas of Pakistan generally have a high demand for cigarettes.Religious month of RamdanRamdan effects the consumption of cigarettes. During the month of Ramadan consumption of cigarettes decreases as masses only smoke after fast or those who dont smoke tend to avoid smoking in front of people as it is unwelcomed by the society. outgrowth in population and availability of brandsIncrease in the population of Pakistan along with more availability of cigarettes brands by manufacturers have contributed in increasing the demand and supply of cigarettes. Moreover increasing trend of smoking cosmos considered as fashionable has also contributed towards the increase in consumption. Different varieti es means more choice for consumer. A Daily generation survey revealed that wholesale dealers supply fake and calamitous cigarettes to about 20,000 retailers of Lahore, who sell them to ignorant consumers who can either not tell the difference or sent their children or servants to buy cigarettesNatural disastersNatural calamities is another factor for fluctuation in demand and supply of Cigarettes. The worst floods in 2010 since 1974 modify fertile tobacco-producing land such as in NWFPTaxation and pretentiousnessChanges in tax structure and ostentation affect the production and consumption of cigarettes. An increase in tax results in decrease in production and increase in price thus reducing the demand for cigarettes. pretentiousness level in Pakistan is always increasing, the increase in price level make it worse for manufacturers and government as people shift to smuggled brands which are available at cheaper price. This act result in dismission of revenue to government in terms of taxes and loss of sales for manufacturersporter.jpgPorters five Forces ModelBy using Porters Five Forces Framework we will discuss five basic competitive forces within the tobacco industry. The threat of potential new entrants, the dicker major power of suppliers, the bargaining power of buyers, the threat of tacks, and the period of competitive rivalry.Threat of new EntrantsThe barriers to entry in the Pakistan tobacco industry are low mainly due to less competition in the industry and local companies can easily enter the market yet the barriers to enter the market nationally are very high. The reason for high barriers at national level is due to high manufacturing, distribution and market represent which makes it difficult for local companies to sustain themselves at national stage. High investment cost is required to build production facilities that can fabricate tobacco products at the national level. Moreover packaging cost of cigarettes nationwide is very high which cannot be afforded by the new local firm.Brand identity is another barrier to entry in Pakistan Tobacco industry. Brand sentience is very important in any industry. In Pakistan government has oblige restriction on advertising. The ban on cigarettes adverstising is acting as a barrier to entry because advertising and communication is required to product strength in the mind of consumers. This ban is also effecting existing companies in a way that they cannot reinforce their current brands and will find encumbrance in launching new brands. High brand loyalty in Tobacco industry is another entry barrier for new firms. object lesson Benson Hedges users will not shift to a new product because of high emotional attached to it.Bargaining power of SuppliersIn Pakistan tobacco industry raw material for cigarettes is provided by farmers to manufacturers. Apart from Green Revolution awkward products have been exploited in all decades this as resulted in low prices of agricultural products but throughout Pakistan history policies have been favoring industries, finished goods are sold at higher price whereas raw material are bought at lower prices. In Tobacco sector supplier has less bargaining power because of less competitors in tobacco industry. Many of the tobacco farmers are located in NWFP, Punjab. Even though government has imposed minimum price but it has been ineffective due to dominance of multinational firms in the tobacco sector. Multinational have bargaining power because they control more than 70% of the market thus illustrating that the farmers have little bargaining power due to the government interaction.Bargaining power of BuyersEconomy plays an important role in buying cigarettes in tobacco industry. As we contend Pakistan economy is uncertain with high unemployment, increasing inflation and political instability. These factors affect the buying power of consumers. Buyer power in tobacco industry also depends on expendable income. A declin e in buyers disposable income results in buying cheaper brands of cigarettes and if a buyers disposable income increases, then they are more likely to buy more expensive brands. By looking at the current scenario Pakistan Tobacco Company launched a low price brand Capstan which became very popular among consumer and captured 14% of market share which effected the market share of Philip Morris brand Moven gold. A recent example of Pakistan Tobacco Company increased the price of Dunhill which resulted in decrease of their market share as consumers shifted towards low price brand Capstan.Consumers in the United States are now increasingly becoming more concerned with health issues. Consumer health awareness has hurt the market for tobacco sellers and has also led to the increase for government regulation. But in Pakistan which has more population than United States serves as an showy market. Moreover less government regulation results in cigarettes manufacturers exploiting consumers.T hreat of SubstitutesThe biggest substitute for tobacco users is to just de-escalate using any type of tobacco product. many companies are trying to make product which is beneficial for the smokers to dispense with smoking, for this purpose they started campaign promoting awareness regarding health isssues. There are many services to help people using tobacco. As health issues and diseases increases day by day so people themselves willing to quit smoking for this purpose they started using different product or services like they started workout which would be the motivating factor or them to quit smoking. There are also some government websites which teaches different method to quit smoking and come through a healthier life. Some people prefer to consult doctor and they provide them with prescription tablets or pills which would make them able to forget about smoking and it would be a source for them to eff normal life, this also be one of the substitute for tobacco products. .T here are many benefits which motivates the consumer of tobacco to quit like smokers will to live the heather life would be the motivating factor other than this the cost involves in getting cigarette is very high and due to inflation and rising prices of the cigarette consumer could not afford to have additional items into their casual routine so they started involved in different methods to quit smoking and Buyer propensity toward tobacco substitutes seems to have increased over time with the evidence that smoking can lead to health risks such as lung cancer, emphysema, heart disease, pregnancy complications, and other health problems. combative rivalryCompetitive rivalry in tobacco sector is sensitive to high because more than 70% of the tobacco market is controlled by Pakistan Tobacco Company and Phillip Morris Pakistan. Both firms are involved in intensive price wars in order to get a market share. Dominant firm like PTC is continuously decreasing its in order to maintain its m arket leadership. Pakistan Tobacco Company reduced the price of its medium-price to sustain market share. This triggered threat to Philip Morris Pakistan as they also had to reduce their prices. Pakistan Tobacco Company controls the largest market share at around 60%. Pakistan tobacco company brand gold flake contributes largest revenue for the company. Both companies have divided their brands into different segments to cater different income class people. Even though the volume of cigarettes have been steady for the past few years the revenue continue to increase, thus making cigarettes manufacturers financial assign trueheartederRivalry in the low and medium sector of cigarettes has been a strong focus of the leading companies in recent years. The market for low and medium category is increasing in country mainly because of the income level in Pakistan. Pakistan Tobacco Company leads in this sector by having around 3 brands for medium and 1 brand to cater low income class. With the potential growth in middle and low category Pakistan Tobacco Company introduced another brand by name Capstan by mall pall even though it had Capstan brand. Philip Morris are also introducing new brands under medium and low category to extract the profitability.By using the Porters Five Forces Framework we were able to discuss the five basic competitive forces within the tobacco industry. The level of difficulty for new entrants the lack of bargaining power of suppliers the bargaining power of buyers between different brands the high level of potential substitutes and the competition rivalry, as well as domestic growth areas were all analyzed within the tobacco industry using the Porters Five Forces Framework. Dominant forces such as government regulation and health awareness influence change in the tobacco industry. The potential impact that theses forces could play on the tobacco industry could be harsh if companies dont adjust and change with them.MAJOR PLAYERSPakistan Tobacc o Company LTDIn 1947 Pakistan Tobacco Company Limited was established. The company congratulate itself for being the first multi-national company to start its business in Pakistan. Pakistan Tobacco Company is the subsidiary company of British American Tobacco which started its operations for over 100 years now and dealt in over 180 countries. The Company has international reputation for manufacturing and marketing high quality brands for the adults.PTC is one of the leading companies in Pakistan. PTC has two art factories in two different states and has more than 1,700 people working there and more than a million people working in various aspects of the business indirectly. PTC is the market leader. PTC has a pile of being the leaders of growth, champions of productivity, responsibility and a leading organizationPerformanceClipboard01gross employee turnover of ptc.bmpThe gross revenue was increased of about 67 million in year 2011 from 60 million in year 2010 because of the succes sful door of brand capstan which occupied 14% of the market share. In 2011, the growth was initiated by new performance of its brand Capstan established in July 2010. PTC captures a market share of about 49.4 percent in the overall market. At the blood of 2012, the companys brands have performed well against the competition. The 77 percent increase in such marketing, distribution and selling activities during the period, the operating margins decreased to 9.76 percent in 2012 from 10.27 percent in 2011. The operating margin declined, but still the Company was able to control costs during the period. The gross profit increased to 30.71 percent in 2012 from 25.75 percent last year as